Plate Tag

by admin on May 31, 2009

Plate Tag Plate Tag

The production of recombinant proteins Gst L1, E6 and E7 HPV 16 tags to be used in the detection of Luminex antibody determination among the population Tunisian male Wi

Production of GST recombinant proteins L1, E6 and E7 HPV 16 labels for use in LUMINEX test for detecting antibodies population in Tunisian women with cervical cancer and controls

Achour. M * A, Ben Younes. Ra, Kahla. Sa Kochbati. LB, Zeghal. DC, Maalej. Mo, Zouari. FC Oueslati. Ra

to a laboratory for Immuno-and Environmental Microbiology (Unit carcinogenesis IMEC), Faculty of Sciences Bizerte, Tunisia Zarzouna 7021.
b Department of Radiotherapy Azeiz Cancer Institute Salah Tunis.
c Department of Gynecology and Obstetrics Birthing Center and Neonatal Hospital Rabta of Tunisia.

* Corresponding author
Achour Mongia
E-mail: mahaachour2000@yahoo.fr
Tel: 216 72 591 845
Fax: 216 72 590 566

SUMMARY:

Some types of Human Papillomavirus (HPV), mainly HPV types 16 and 18 were recognized as key etiological factors for development of cervical cancer. Antibodies against HPV was found associated with changes in cervical cancer. Several tests can be used to detect antibodies, but have low levels of sensitivity and specificity. In this work, we are interested in preparing recombinant proteins for use in technology Luminex to present the serological study of the female population of Tunisia. Thus, HPV 16 L1, E6 and E7 sequence fused at its 3 'end of coding undecapeptide sequence administration of SV40 large T antigen (TAG) were isolated from plasmids and inserted into an expression vector pGEX protein GST fusion in E. coli. The coding sequences for L1tag, E6tag and E7tag HPV 16, respectively, have been mobilized by digestion with enzymes and ligated into plasmids digested area downstream of the GST. An expression plasmid for the GST tag was constructed by inserting a fragment encoding the epitope tag. The cells E. coli BL 21 was transformed with pGEX plasmids and grown up in Luria Bertani with ampicillin. Expression of protein expression was induced by adding 0.25 mM isopropyl--D-thio-galactoside (IPTG) average. Bacteria were harvested after induction and bacteria granules were resuspended in a solution in phosphate buffered saline (PBS) and lysed with a high pressure homogenizer. Lysates were approved by centrifugation.
The proteins were verified by migration sodium dodecyl sulfate (SDS) gel electrophoresis. The data showed that they remained stable for the detection and the lysates were stored at -20 ° C for use on Luminex for the detection of antibodies in the female population of Tunisia. This test demonstrated that the sero-positivity against different antigens in different groups studied and differences between cases and controls were significant (P
Keywords: GST Tag - E. coli - HPV 16 - L1 - E6 - E7 - Luminex

INTRODUCTION:
A level Globally, the human papillomavirus (HPV) is estimated to cause nearly half a million cases and 270,000 deaths from cervical cancer, which is more than 2.5 million years of life lost (YLL) by (year Sue et al., 2007).
HPV type 16 (and to a lesser degree HPV type 18) is linked to rare cancers, ie, cancer of the vulva, vagina, penis, anus, oropharynx and larynx. Effective prophylactic vaccines have been developed (Dillner et al., 2007). Epidemiological studies Molecular showed that specific subtypes of HPV are associated with cervical cancer (Castle and Giuliano, 2003; Dillner and Brown, 2004).
The HPV group currently consists of over 100 fully characterized. Partial sequences of new isolates indicate that at least 100 are other HPV. Of these, 15 genital HPV oncogenes are human beings. HPV type 16 is by far most important viruses, which represents over 50% of cervical cancers. HPV16 cancer is even more dominant in the etiology of HPV-associated noncervical (Dillner, 2005). HPV serology is complex for several reasons. Different types HPV can infect the epithelium of the skin or mucous membranes and cause proliferative diseases. HPV antibodies are type specific. Those are the main proteins Viral capsid L1 are the markers of infection, and those that target oncoproteins E6 and E7 are markers for HPV-associated cancer (Waterbed et al., 2005). The conventional methods such as ELISA serological allow analysis of serum antibodies to only 1 per well. Previous studies have identified antibodies against antigens before E6 protein ELISA methods using linear epitopes of small proteins, but sometimes they show less sensitivity and specificity. To improve the immunologic method, other approaches have been suggested as evidence of radio-immunoprecipitation (RIPAS) in all native proteins and sandwich ELISA with a length Total (Meschede et al., 1998). Today, HPV serology is mainly in a limited number of laboratories, but is likely to be widely used in clinical laboratories in the post-vaccination sera against HPV. LUMINEX Previous studies have shown that the method is an attractive method for laboratories HPV serology broadband (Waterbed et al., 2006).
In this report, viral antigens were expressed in Escherichia coli pGEX vectors as proteins merger with two N-terminal GST and a C-terminal peptide (TAG), composed of 11 C-terminal amino acids of large T antigen of simian virus 40. Concentrations Authorized protein lysates were determined by Bradford-reactive and characterization of recombinant protein was verified long-term Coomassie stained SDS-PAGE. Furthermore, assessment of antigen lysate was performed using mouse anti-label. These antigens are used in LUMINEX test for detection of antibodies in the female population of Tunisia.

MATERIAL AND METHODS:

HPV 16 L1

A change pGEX vector was constructed for the expression of the GST fusion protein with an extra C-terminal fusion tag in E. coli. HPV-16 L1 coding sequence lacking 10 N-terminal residues was amplified by reaction polymerase chain reaction PCR with SmaI / SalI ends and inserted into pGEX4T3tag opened by EcoRI digestion.

PCR:

HPV 16 L1 before 5'GCAGTCCCCGGGGTCTACTTGCCTCCTGTCC
L1 HPV-16 CA 5'GCATGAGTCGACCAGCTTACGTTTTTTGCGTTTAGC

E. cells of E. coli BL21 transformed with plasmids pGEX grew at room temperature in the middle Luria Bertani containing 1 mM ampicillin; OD600 of 0.3 in a recombinant protein expression was induced by the addition of 0.25 mM isopropyl--D-thio-galactoside (IPTG) average. Bacteria were harvested by centrifugation 15 h after induction. Pellets were resuspended bacteria in 40 mM Tris pH 8, 200 mM NaCl, 1 mM EDTA (ethylenediaminetetraaceticacid) and 2 mM DTT (dithiothreitol), supplemented with the complete cocktail of protease inhibitors and a lysate high pressure homogenizer. ATP (adenosine triphosphate) and MgCl2 were added to the final concentration of 2 mm and 5 mm respectively (Sehr et al., 2001).
HPV-16 E6 and E7

HPV type 16 E6, 16 E7 fusion coding sequence at its 3 'end of the coding sequence within the large terminal undecapeptide SV40 T antigen (Tag) is isolated from Bluescript plasmid and inserted into a pGEX expression vector as GST fusion protein in E. coli. These coding sequences E7tag for E6tag and mobilized by digestion and ligated into the digested plasmid downstream area of the GST.
Then, E. coli BL 21 cells transformed with plasmids pGEX were grown and induced protein expression was obtained as described above for L1. The bacteria were harvested 6h after induction by centrifugation. Pellets were resuspended bacteria in PBS with 2 mM DTT, 1% Triton X-100, and complete cocktail of protease inhibitors and lysis in homogenizing high pressure. Lysates were then cleared by centrifugation and stored in aliquots at -20 ° C (Sehr et al., 2002).

Assessment of protein

- To identify different lysate concentrations, the method of Bradford-reactive
as described above. Optical density was measured at 595 (nm Bradford, 1976).
Polyacrylamide - Separation of recombinant proteins was carried out by migration, 12% of gel electrophoresis and bands were visualized by staining with Coomassie.
- Evaluation of antigens: L1tag Lysates for GST and GST and GST E6tag is E7tag diluted in 1 / 3 steps begin with the final concentration of 2 mg / Pl and the detection of antigens has been welcomed by anti-mouse antibody tag diluted 1 / 4000, density optics was determined at 450 nm.

LUMINEX

Hardware and Software measures are performed in a total of 100 Luminex analyzer system includes the Luminex 100, Luminex XYP plate driver, Luminex SD through the fluid distribution system, a Pentium 4 personal computer (Dell) with Windows 2000 (Microsoft Corp.), and Luminex is 2.2 SP1software (Waterbed et al., 2005).
Multiplex serology has been described in detail by Waterbed et al., 2005. Briefly, the method uses derivatized accounts with glutathione, allowing the heels Mediation affinity purification of viral antigens in situ by bacteria expressed as fusion proteins GST.
Series spectrally different ball bearing different viral antigens were washed separately, then mix. Each serum sample diluted in buffer preincubation unfiltered and joint accounts are combined and incubated. Bound antibodies were detected anti-human biotinylated secondary antibodies (goat anti-human IgG) and conjugated detection fluorescent (Rphycoerythrin streptavidin). With the Luminex analyzer, accounts reporter fluorescence was determined expressed as mean fluorescence intensity (MFI).
The viral antigens were expressed in Escherichia coli pGEX vectors as fusion protein with dual GST N-terminal and C-terminal peptide (TAG), composed of 11 C-terminal amino acid large T antigen of simian virus 40. The constructed expression for E6, E7 and L1 of HPV 16 as GST fusion proteins were described (Sehr et al., 2001, 2002).
Bacterial lysate was diluted to 1 g / L in casein buffer (1 g / L of casein in PBS, pH 7.4). For each antigen, Ball GC were loaded with GST fusion proteins directly in the lysate and incubated for 1 hour at room temperature in the dark on a shaker. The beans are washed 3 times with 1 ml of buffer casein. Serum from a case-control study divided into 70 controls and 71 cases of cervical cancer. Ethics committee approval and informed consent of the Participants in the study of HPV serology were obtained. Sera were incubated at a dilution of 1:50 in a shaker for 1 hour at room temperature in a buffer Pre-incubation of serum casein-based buffer and 2 g / L of lysate from bacteria expressing GST alone blocking antibodies directed against proteins residual bacteria and GST.

Multiple Testing:

Beads carrying different sets of antigens were mixed and 50 ml of each diluted serum incubated with Mixed beads were combined into 96-well plates, the bottom of the filter and incubated on a shaker for 1 hour at room temperature in the dark. Beads were washed 3 times in 100 buffer UT casein in a vacuum in the collector. Biotinylated secondary antibody [goat anti-human IgG diluted 1:1000 in casein buffer was added and incubated as before. After washing the combined detection (streptavidin-R-phycoerythrin) diluted 1:1000 in casein buffer was incubated with beads for 30 min. The accounts were washed again, and wells were filled with casein buffer. Rapporteur of the fluorescent beads was determined with the Luminex analyzer and expressed as mean fluorescence intensity (MFI). To calculate the antigen specific reactivity, the MFI of GST tag was removed from the antigens of MFIs. This method multiple HPV serology in affinity purified viral antigens in situ developed however, for a classical GST capture ELISA as previously described (Sehr et al., 2001).

RESULTS:

Using the method of Bradford, we have determined the three concentrations of lysate protein by measuring the optical density at 595 nm. L1tag GST GST GST E6tag and E7tag following concentrations: 16, 19 and 23.5 mg / Pl, respectively.

The bacteria are used to L1tag overexpressing GST (lane 3), GST E6tag (lane 5), GST E7tag (lane 4), the GST tag (lane 2). Proteins were separated by gel electrophoresis and stained with Coomassie.
M. molecular weight marker with molecular mass in kDa is indicated in the left lane (1).
As shown in this figure, the different bands obtained correspond the different recombinant proteins showing apparent molecular weight different. GST L1tag demonstrated by migration on gel electrophoresis with a molecular weight of 82 kDa, and approximately 40-45 kD for HPV 16 proteins E6 and E7 GST fusion, respectively. However, GSTtag showed a band of approximately 31 kDa.
To determine The limit of detection of these proteins, different dilutions are integrated. As shown in Figure 2, and the use of lower concentrations, the best detection obtained for GST alone, followed by antigens E6 and E7 and L1.

The data showed that a high percentage of HIV in cervical cancer compared controls the three antigens L1, E6 and E7 LUMINEX analyzed with the test: 21%, 44% and 61% respectively and the differences in results between cases and controls were significant (P Furthermore, the Luminex technology enabled us to determine the intensity of the antibody response by analysis of MFI values determined for the different groups of patients to the three antigens tested. The data showed that cases of cervical cancer, the distribution values of MFI is different and depends on the type of antigen and the increased intensity of fluorescence was observed for the E6 and E7 antigens of early versus late antigen L1. In fact, these values do not exceed of 5,609 units because, while L1 for E6 and E7, large MFIs reaching 13,317 and 13,235 were recorded for E6 and E7 antigens, respectively.

DISCUSSION:

In this work, we produce three recombinant proteins for HPV-16 and GST L1tag, E6tag GST and GST in E. E7tag coli. After production, we saw the size of the protein separation by gel electrophoresis and the results were in agreement with the literature (Sehr et al., 2001, 2002).
Previous studies have shown that different systems can be used to produce the expression viral HPV 16 (Biemelt et al., 2003). In fact, virus-like particles (VLP) were expressed in different systems: mammalian cells, yeast, baculovirus, transgenic plants, Semliki Forest Virus, Salmonella and E. coli (Sasagawa et al. 1995; Hagensee et al. 1993; lyengar et al. 1996; Kirnbauer, et al., 1993, NEEP et al. 1996). Among the different systems can be used, the literature has reported that the yeast can produce significant quantities recombinant protein in its native conformation, and possible contamination by toxins or virus infection is minimal compared to bacterial expression systems or mammalian. Furthermore, yeast is a suitable host for heterologous protein production eukaryotes, since it allows post-translational polypeptides, such as folding and phosphorylation. In fact, previous studies have expressed HPV 16 E7 protein in Schizosaccharomyces pombe and have used a purification protocol (BRASPENNING et al., 1997).
Yeast as SZ. pombe is a system that has several advantages (Yuko et al., 1999). In fact, it can be easily manipulated, inexpensive means of synthesis is used, and several milligrams recombinant proteins can be produced. BRASPENNING et al. 1997 have developed the purification protocol of human papillomavirus HPV type 16 E7 protein expressed sz in yeast. chromatography pombe. In his earlier work, the authors E6tag and recombinant proteins expressed E7tag for HPV 16 and 18 in SZ. Pombe (Meschede et al., 1998). The purified recombinant proteins were separated by silver-stained polyacrylamide gels with sodium dodecyl sulfate. Antigen production in plants is known to be safe and potentially very cost effective alternative to traditional expression systems. HPV 16 L1 major capsid proteinhave expressed in Nicotiana tabacum cv. Xanthi plants prophylactic vaccine production. This system is not often easy to make (vars et al., 2003).
In comparison other, the E / coli system used in our work, has the advantage of ease of production and purification of antigens and provide large amounts of proteins that can be used for a wide range of studies, including the antigen and production of vaccines, immunology and structural biochemistry and molecular cell biology studies. Although a variety strains of E. coli host can be used for cloning and expression vector pGEX, some strains of E. coli strain BL 21 maximize protein expression full-length fusion. This strain is defective in the production of T-OMP and Lon protease and is the only strain capable of expressing the fusion protein in a form soluble intact. In addition, glutathione S-transferase (GST) gene fusion system provides an integrated system for the expression, purification and detection glutathione S-transferase fusion protein using E. coli (Hi and Bell, 1998).
More recently, researchers have reported the transient expression through a potato virus X vector derived from the E7 protein secretion system targeting of Nicotiana benthamiana (Franconi et al., 2006).
In addition, verified the production of recombinant proteins L1, E6 and E7 and stability. Superior detection was obtained for GST and the same concentration, detection of E6 and E7 is greater than L1. The observed differences in the production and detection capability with mouse anti-tag recombinant proteins from different L1tag GST, GST and GST E6tag May E7tag be explained by the fact that the L1 protein is relatively high molecular weight, which is why we need more purification steps for the release bacterial protein that can grow with recombinant proteins (Waterbed et al., 2005).
These protein antigens prepared with concentrations of 16, 19 and 23.5 mg / Pl for L1, E6 and E7, respectively, were used in LUMINEX test for detecting antibodies in the sera of Tunisian Women's Rights. This system allowing multiplex antibody analysis of large numbers of sera against different antigens in parallel and has the potential to replace ELISA technology.
Therefore, this method allows simultaneous analysis of many samples of serum antibodies against multiple viral antigens would be useful for studies sero-epidemiological studies of prevalence and disease association of human papillomavirus (HPV).
The literature has reported that antibodies against the HPV type specific. These are the major capsid protein L1 are the markers of viral infection and those that target oncoproteins E6 and E7 are markers of cancer associated with HPV (Dillner, 2005; Waterbed et al., 2005). Data reported in this study showed that the intensity of the antibody response is important for antigens to E6 and E7 early L1 antigen and this can be explained by differences in the characteristics of these proteins. The antibody response against HPV is usually serology and HPV type specific technology is important in determining the spread of certain types of HPV infections in the population and control the impact of HPV vaccines to induce protective antibodies. The literature has shown that antibodies against the major capsid protein of HPV against the protein, L1, are induced after infection and usually remain detectable for years after the disappearance of the infection, since they belong to the class antibody that brand exposure before infection. The levels of these antibodies correlate with protection, and antibody-L1, which are in need urgent effective lighting of HPV serological methods standardized for use in the application of vaccines and evaluation efforts and monitoring the spread Epidemiology of HPV type-specific (Dillner, 2005).
In the present work is best used Luminex sensitivity and antibody response can replace conventional serological methods such as ELISA, which allows analysis of sera antibodies to only 1 per well. However, this method for multiplex HPV serology analysis matrix fluorescent beads combined with a generic method for affinity purification in place in all glutathione S-transferase (GST) fusion protein developed for conventional ELISA.
The high density arrays plane can analyze a large number of targets, but are limited in the number of samples can be analyzed within reasonable costs acceptable.
In conclusion, the production of recombinant proteins in E. coli allowed us to obtain the recombinant proteins of HPV types, and many other proteins with relative ease and in large quantities. Increased sensitivity and imprecision Low method based on Luminex and the possibility that a simple combination of different antibody tests lead to a renewed interest in the use of these antibodies predictive oncology.
Furthermore, using Luminex technology and in countries without a cervical screening program in our country, we can investigate Feasibility analysis of serology for the study of sero-epidemiological or immunization in the female population of Tunisia through the parallel analysis antibodies against three antigens (E6, E7 and L1 proteins, HPV type 16).

Acknowledgments:

We thank Dr M Pawlita and Dr. P, and Dr. Sehr Waterboer.T DKFZ Heidelberg, Germany) for giving me all the goods and materials needed for the implementation of Luminex.

References:

Biemelt S, Sonnewald U, P Galmbacher, Willmitzer L, Muller M (2003). Production of human papillomavirus type 16 virus-like particles in transgenic plants. J. Virol. 77: 9211-9220.

Bradford MM (1976). A rapid and sensitive method for quantification of protein utilizing the principle of protein dye binding. Ana Biochem. 72: 248-254.

BRASPENNING J Manetti R, Zumbach K, Meschede W, Gissman L, Tommasino M (1997). A general protocol for protein purification E7 "high and low risk human papillomavirus types expressed in the yeast Schizosaccharomyces pombe. Prot Expr. Purif. 10: 192-201.

Castle PE, Giuliano AR (2003). Reproductive tract infections, cervical inflammation and antioxidant nutrients - assessing their roles as cofactors in human papillomavirus. J. Natl. Cancer. INST. Monogr. 31: 29-34.

Dillner J, Brown DR (2004). Can the human genital tract infection HPV and cervical cancer of the uterus can prevent with a vaccine? Experts. Rev. Mol. Med 9: 1-21.

Dillner J (2005). To "Serolomics": Papillomavirus Serology Take a Lead Technology high performance in multiplexed antibody analysis. Clinic. Chemistry. 51: 1768-1769.

Dillner J, Arbyn M, Dillner L (2007). Translational Mini-Review of the series of vaccines: Monitoring of vaccination against human papilloma virus. Clin. Exp Immunol. 148: 199-207.

Franconi R, Massa S, Illiano E, Mullard A, Cirilli A, Accardi L, P, Di Bonito, Giorgi C, Venuti A (2006). Exploiting the plant secretory pathway to improve the anticancer activity of plant-derived vaccine HPV E7 16. Int J. Immunopathol. Pharmacol.19: 187-197.

Hagensee ME, Yaegashi N, Galloway Dan (1993). Self-assembly of human papillomavirus type 1 capsids by expression L1 protein alone or by coexpression of capsid proteins L1 and L2. J. Virol. 67: 315-322.

Iyengar S, Shah KV, KOTLOFF KL, Ghim SJ, Viscidi RP (1996). Self-assembly in vitro-translated human papillomavirus type 16 capsid protein L1 virus-like particles and antigenic reactivity of the protein. Clin. Diagn. Lab. Immunol. 3: 733-739.

Kirnbauer R, Taub J, Greenstone H, Roden R, Durst M et al, Lowy DR, Schiller JT (1993). Efficient self-assembly of papillomaviruses type 16 L1 and L2, L1 virus-like particles. J. Virol, 67: 6929-6936.

Meschede W, Zumbach K, BRASPENNING J, Scheffner M, McCollum LB, Luanda J Gissman L, Pawlita M (1998). Antibodies against early proteins of human papillomaviruses as diagnostic markers for invasive cervical cancer. J. Clin. Microbiol. 36:475-80.

NEEP M. P, Hofmann KJ, Jansen KU (1996). Expression of the major capsid protein of human papillomavirus type 11 in Saccharomyces cerevisiae. Gene.18: 1-6.

Greetings M, Bell PA (1998). Troubleshooting GST fusion protein expression in E. coli. Life Science News, Amersham. Biosciences: 1-3.

Sasagawa T, P Cannon, G Steers Gschmeissner SE Hajibagheri MA, Finch J, Crawford L, Tommasino M (1995). The synthesis and assembly of virus-like particles of human papilloma Type 6 and Type 16 in the fission yeast Schizosaccharomyces pombe. Virology. 206:126-135.

Sehr P, Zumbach K, Pawlita M (2001). A generic capture ELISA recombinant proteins fused to glutathione S-transferase: validation for HPV serology. J. Immunol. Methods. 253: 153-162.

Sehr P, Muller H, R Höpfl Widschwendter A, Pawlita M (2002). The detection of HPV antibodies by ELISA with capsid protein L1 fused to glutathione S-transferase. J. Virol. Methods. 106: 61-70.

Sue JG, Jane K., Katie K, Jeremy DG, Joshua S, Meredith KH O'Shea, F. Xavier B, Silvia Sanjos'ec, Eduardo LF (2007). Cost-effectiveness HPV 16, 18 vaccination in Brazil. Vaccine. 25: 6257-6270.

Vars to, Williamson AL, Rose RC, Jaffer M, Ribicki EP (2003). Expression of papillomavirus 16 Type of human major capsid protein in transgenic Nicotiana tabacum cv. Xanthi. Arch. Virol. 148: 1771-1786.

Waterbed T, Sehr P, Pawlita M (2006). Remove non-specific binding in serological Luminex. J. Immunol. Methods. 309: 200 - 204.

Waterbed T, Sehr P, Michael KM, Franceschi S, Nieland JD, Joos TO, Templin MF, Pawlita M (2005). Serology of human papillomavirus status based Multiplex glutathione S-transferase fusion proteins purified. Clin. Chem. 51: 1845-53.

Yuko GH, Hiromichi K (1999). System expression of foreign genes using the yeast Schizosaccharomyces pombe. Biotechnol. Appl. Biochem. 30: 235-244.

About the Author

Corresponding author:

Achour Mongia

Pilot Automotive Plate Tag Frame with a Backup Sensor Review - etrailer.com

eBay Logo  

PORTMEIRION 8


PORTMEIRION 8" SQUARE PLATE SWEET PEA NEW WITH TAG


$19.99


LENOX CHARLESTON Dinner Plate - NEW WITH TAGS - MORE AVAILABLE


LENOX CHARLESTON Dinner Plate - NEW WITH TAGS - MORE AVAILABLE


$24.99


Lefton Hand Painted Fruit Plate Apples Grapes Figs Pear Peach 8


Lefton Hand Painted Fruit Plate Apples Grapes Figs Pear Peach 8" Original Tag


$19.99


NEW WITH TAGS SET OF 2 Pier 1 Hand-Painted Lunch? Plates (Or Salad) Wavy Stripe


NEW WITH TAGS SET OF 2 Pier 1 Hand-Painted Lunch? Plates (Or Salad) Wavy Stripe


$8.00


Capodimonte Rose on Silver-Plated Pedestal Porcelain Pink Rose with tag


Capodimonte Rose on Silver-Plated Pedestal Porcelain Pink Rose with tag


$9.99


FITZ AND FLOYD


FITZ AND FLOYD "HATTORI" SALAD PLATE (7 1/2 INCHES)-1979 FF 67-NEW WITH TAG


$20.99


PFALTZGRAFF JAMBERRY 11


PFALTZGRAFF JAMBERRY 11" Footed Pedestal Cake Plate - New With Tags Unused


$54.99


ROYAL DOULTON ENGLAND GRANTHAM 10


ROYAL DOULTON ENGLAND GRANTHAM 10" DINNER PLATE #D5477 WITH TAG ATTACHED PREOWN


$25.00


Pier 1 Toscana Ivory Dinner Plates (Set of 4) New With Tags - FREE SHIPPING!


Pier 1 Toscana Ivory Dinner Plates (Set of 4) New With Tags - FREE SHIPPING!


$49.77


D'Arques / Durand Carthage Crystal Footed Plate Cake Stand NIB w/ Tags Chip


D'Arques / Durand Carthage Crystal Footed Plate Cake Stand NIB w/ Tags Chip


$31.45


Portmeirion Botanic Garden 8


Portmeirion Botanic Garden 8" salad plate square Lily Azalea new with tags


$15.99


5 Lenox China Holiday Salad Plates-8 Inch-New with Tags-MINT


5 Lenox China Holiday Salad Plates-8 Inch-New with Tags-MINT


$55.99


Spode Christmas Tree Salad Plates, Set of 8 new with tag


Spode Christmas Tree Salad Plates, Set of 8 new with tag


$99.99


 POLISH POTTERY SALAD/DESSERT PLATES SET OF 2-NEW W/TAG


POLISH POTTERY SALAD/DESSERT PLATES SET OF 2-NEW W/TAG


$28.00


PORTMEIRION REINE CLAUDE PLUM 7.25 PLATE NEW NO TAG


PORTMEIRION REINE CLAUDE PLUM 7.25 PLATE NEW NO TAG


$19.99


Tag Ltd SONOMA RED Dinner Plate 5594223


Tag Ltd SONOMA RED Dinner Plate 5594223


$14.99


Tag Ltd China SONOMA GREEN Salad Plate 4015658


Tag Ltd China SONOMA GREEN Salad Plate 4015658


$11.99


Tag Ltd SONOMA IVORY Dinner Plate 5594222


Tag Ltd SONOMA IVORY Dinner Plate 5594222


$14.99


Tag Ltd SONOMA GREEN Dinner Plate 4015657


Tag Ltd SONOMA GREEN Dinner Plate 4015657


$14.99


Tag Ltd SONOMA TAN Dinner Plate 5594219


Tag Ltd SONOMA TAN Dinner Plate 5594219


$14.99


Tag Ltd China SONOMA 2 MUSTARD Dinner Plate 5594439


Tag Ltd China SONOMA 2 MUSTARD Dinner Plate 5594439


$16.99


Tag Ltd SONOMA BLUE Dinner Plate 4015649


Tag Ltd SONOMA BLUE Dinner Plate 4015649


$16.99


Tag Ltd China SONOMA BLUE Chop Plate or Round Platter


Tag Ltd China SONOMA BLUE Chop Plate or Round Platter


$26.99


Fiestaware Evergreen RETIRED Salad/side plates-set of 8-NEW w/ tags 1st quality


Fiestaware Evergreen RETIRED Salad/side plates-set of 8-NEW w/ tags 1st quality


$11.50


MIKASA FRENCH COUNTRSIDE MARIGOLD SALAD ACCENT SIDE PLATE  F9000 NEW W TAG


MIKASA FRENCH COUNTRSIDE MARIGOLD SALAD ACCENT SIDE PLATE F9000 NEW W TAG


$15.99


MIKASA ITALIAN COUNTRSIDE ROSE SALAD ACCENT SIDE PLATE  DD923 NEW W TAG


MIKASA ITALIAN COUNTRSIDE ROSE SALAD ACCENT SIDE PLATE DD923 NEW W TAG


$15.99


Tag Ltd China SONOMA 2 GREEN Dinner Plate 5594440


Tag Ltd China SONOMA 2 GREEN Dinner Plate 5594440


$14.99


Tag Ltd China SONOMA 2 NATURAL TAN Salad Plate 5594449


Tag Ltd China SONOMA 2 NATURAL TAN Salad Plate 5594449


$14.99


Tag Ltd China SONOMA 2 LIGHT GREEN Dinner Plate 5594442


Tag Ltd China SONOMA 2 LIGHT GREEN Dinner Plate 5594442


$14.99


Tag Ltd China SONOMA 2 NATURAL TAN Dinner Plate 5594441


Tag Ltd China SONOMA 2 NATURAL TAN Dinner Plate 5594441


$16.99



Zak Designs Confetti Assorted Brights Mixing Bowls, Set of 4


Zak Designs Confetti Assorted Brights Mixing Bowls, Set of 4


$28.19


Zak Designs has always maintained a strong commitment to the Earth and the environment. That commitment has been elevated to a new level with the introduction of Confetti. Zak's confetti line is from recycled durable 100% melamine, being environmentally friendly never looked so fun...

Tag Whiteware Porcelain Ceramic Lidded Butter Keeper, 7-1/4-Inch Long, White


Tag Whiteware Porcelain Ceramic Lidded Butter Keeper, 7-1/4-Inch Long, White


$14.15


Square design of this white porcelain covered butter will complement tag's assortment of square porcelain plates and serving accessories....

1950's Vintage Style Happy Birthday Tablecloth


1950's Vintage Style Happy Birthday Tablecloth


$22.98


A wonderfully faithful reproduction of the classic 1950's Happy Birthday tablecloth! Decorate your table with this fabulous design featuring confetti, balloons, noisemakers, party hats, streamers and candy cups! Size: 52" x 52" 100% cotton.

Order 2 and combine for larger table sizes....


Share and Enjoy:
  • Digg
  • del.icio.us
  • Facebook
  • Mixx
  • Google Bookmarks
  • LinkedIn
  • Live
  • MySpace
  • NewsVine
  • Reddit
  • StumbleUpon
  • Technorati
  • Twitter
  • Yahoo! Buzz
Tags: , , , , ,

Related posts

Leave a Comment

Spam Protection by WP-SpamFree

Previous post: Dinnerware Service

Next post: Mosse Pottery